Pandora Earrings

A free responsive blog by Pandora Earrings

pandora beads for cheap

 Twitter  Facebook  Google+

    PANDORA Floral Daisy Lace Ring 190992 official online sale

PANDORA Floral Daisy Lace Ring 190992 official online sale

Pandora Floral Daisy Lace Ring 190992
...

PCR correlates with immunocytochemistry for the detection of disseminated epithelial cells in bone marrow aspirates of patients with breast cancer This sensitivity may lead to false positivity.

Immunocytochemistry (ICC) is regarded as the standard methodology to diagnose DEC. In this study, detection with ICC was compared with quantitative real time RT for CK 19 and mammaglobin (hMAM) mRNA in bone marrow (BM) of patients with metastatic breast cancer (MBC). Bone marrow was aspirated from 14 control patients and from 29 patients with MBC. Mononuclear cells (MNC) were isolated. Immunostaining was carried out with the Epimet kit. Quantitative PCR was performed on the ABI Prism 7700. The pandora beads for cheap CK 19 and hMAM mRNA quantities were normalised against and calculated relative to a calibrator sample (relative gene expression). All controls were negative by ICC and for hMAM expression measured by RT whereas the median RGE value for CK 19 was 0.57. For the MBC patients, the median RGE for hMAM was 0 and 10 out of 25 (40 tested positive. Median RGE for CK 19 was 2.9 and 20 out of 25 (80 tested positive. With ICC, the median value was 1 stained cell per sample, and 15 out of 24 (62 samples were positive. A correlation was observed between CK 19 and hMAM expression (r P and between hMAM expression and ICC (r P CK 19 expression and ICC (r P showed the strongest correlation. Reverse transcriptase chain reaction for CK 19 resulted in a higher number of positive BM samples of patients with MBC than ICC. Since an excellent correlation is observed between ICC and RT and RT is probably more sensitive with the advantage of being less observer dependent and thus also more easy to automate, we consider our quantitative real time RT method as validated for the detection of DEC in the bone marrow of breast cancer patients. Keywords: RT breast cancer; bone marrow; circulating tumour cells; cytokeratin 19; mammaglobin In the Western world, nearly one out of nine women develop breast cancer. The majority of these patients do not have evidence of metastatic disease using conventional diagnostic techniques. However, almost 30 of patients with stage I or stage II disease will die of metastasis, probably implying that dissemination, although undetectable, had already occurred at the moment of diagnosis. Detection of disseminated epithelial cells (DEC) in the blood marrow (BM) compartment unique pandora charms is still in the experimental phase. Molecular diagnostic techniques have, however, been integrated in the revised tumour node metastasis (TNM) staging system for the detection of metastatic tumour deposits in lymph nodes of patients with breast cancer (Singletary et al, 2002). The standard method to detect DEC in BM is immunocytochemistry (ICC). For patients with breast cancer, several studies demonstrated that the presence of ICC stained cytokeratin positive cells in the bone marrow is associated with a poor prognosis (Diel et al, 1996; Braun et al, 2000; Janni et al, 2000; Gerber et al, 2001; Singletary et al, 2002; Wiedswang et al, 2003). The value of this cytological method is limited by its low sensitivity, and is highly dependent on the experience of the observer. An additional well known problem is the false positivity of some haematological cells (Borgen et al, 1999). Since the introduction of molecular based techniques, more sensitive quantitative methods have been developed, for instance, based on PCR methodology. This approach is aimed at the amplification of specific abnormalities present in the DNA of tumour cells. Since the common solid tumours rarely have specific genetic abnormalities, the use of DNA based methods is precluded. The most commonly used molecular method for the detection of DEC relies on the screening for tumour associated and organ specific mRNA expression in cancer cells and on the absence of these gene son pandora charm products in the cells of the host tissue such as BM. The identification of an appropriate target gene is one of the most critical steps in the reverse transcriptase chain reaction (RT approach to quantify DEC. Cytokeratins are widely evaluated as targets for the detection of DEC, but many studies have reported on the problem of false positivity, for example, with the detection of CK 19 mRNA, which may be explained by illegitimate expression by nonepithelial cells (Chelly et al, 1989; Ko et al, 2000). Combining markers may increase both the specificity and the sensitivity of the detection of DEC. Human mammaglobin (hMAM), a member of the uteroglobin gene family, was reported to be exclusively expressed in mammary epithelium (Watson and Fleming, 1996; Watson et al, 1999), making it a potentially useful RT target. A prerequisite for the prognostic evaluation of DEC in the BM quantified by RT and the aim of this study, is the proof of a stochastic correlation of the molecular quantitative method with ICC based quantification of DEC. Some studies (Schoenfeld et al, 1997; Zhong et al, 1999) have adopted the molecular approach, but not in a quantitative manner, having expressed the BM as being DEC positive or negative. Slade (1999) and Smith et al (2000) use a competitive quantitative RT assay and compare the results with ICC. In this study, quantification of BM DEC by ICC is compared with quantitative real time RT quantification of CK 19 and hMAM mRNA expression in a control population and in patients with metastatic breast cancer. Top of pagePatients and methodsPatients and methods Results Discussion References Acknowledgements Figures and TablesPatient samplesAfter written informed consent, BM aspirates were taken from 29 patients with metastatic breast cancer and 14 patients with a nonmalignant breast lesion or a haematological malignancy (control patients). In total, 18 of BM was aspirated from the posterior iliac crest under local anaesthesia into syringes containing heparin as anticoagulant. Mononuclear cells (MNC) were isolated by density gradient centrifugation through Ficoll Paque (Amersham Pharmacia Biotech, Sweden) and washed twice with PBS. The samples were then divided into two aliquots, one for each methodology. After centrifugation, the cell pellets were resuspended in a guanidine containing buffer or in PBS, for RT and ICC, respectively. For optimalisation of the assay, BM aspirates were also analysed from 56 consecutive patients with operable breast cancer presented in our hospital. The study protocol was approved by the ethical committees of the Faculty of Medicine, University of where to buy charms for pandora bracelet Antwerp, and of the General Hospital Sint Augustinus. ImmunocytochemistryThe MNC suspension was counted and cytocentrifuged onto glass slides at a concentration of 5 105 cells per spot. The cytospin preparations were air dried overnight and then stored at Immunostaining to detect cytokeratin positive cells was carried out with the Epimet (Micromet AG, Germany). This kit uses the monoclonal antibody A45 B a pancytokeratin marker. A total of 2 million cells per patient were screened microscopically by two independent observers. Cells were identified as DEC according to the European ISHAGE Working group for Standardisation of Tumour Cell Detection (Borgen et al, 1999). Results were expressed as the number of positive cells per million MNC (continuous data). A sample was considered to be positive if one or more stained cells were observed in the cytospins (categorical data). Sensitivity was tested on an MNC suspension from a healthy volunteer spiked with 1, 2, 10, 20, 100 and 1000 MCF 7 breast cancer cells per million MNC. RNA isolation and cDNA synthesisTotal RNA was extracted from the MNC using the RNeasy kit (Qiagen, Germany). The amount of RNA was measured spectrophotometrically. The RNA integrity was tested on the Agilent Bioanalyzer. Only samples with lack of degradation on electropherogram and 28S ratio were analysed. To avoid amplification of contaminating genomic DNA, primers and probes were placed on different exons. The forward primer of CK 19 (CCCGCGACTACAGCCACTA) is situated on exon 1, the probe (FAM ACCATTGAGAACTCCAGGATTGTCCTGCA TAMRA) on exon 2 and the reverse primer (CTCATGCGCAGAGCCTGTT) on exon 3. Reverse transcriptase chain reaction using this primer set resulted in a 163 fragment. For hMAM, the forward primer (ATGAAGTTGCTGATGGTCCTCAT) and the probe (FAM CGGCCCTCTCCCAGCACTGC TAMRA) are located on exon 1 and the reverse primer (GTCTTAGACACTTGTGGATTGATTGTCT) on exon 2. The hMAM amplicon consists of 119 The nucleotide sequences of the primers and probes were checked for their specificity in the NCBI BLAST database. A ready to use primer and probe set predesigned by Applied Biosystems (Assay on demand Gene Expression Product number Hs00267190 SCGB2A2) was also used for the detection of hMAM expression. Commercially available primers and probes for GAPDH and mRNA were used for normalisation (Applied Biosystems). These probes are labelled with a VIC dye and to avoid competition in the multiplex PCR reaction tube, the concentrations of the primers are limited. All PCR reactions were performed on the ABI Prism 7700 Sequence Detection System (Applied Biosystems) using the fluorescent Taqman methodology. The PCR cycle at which the fluorescence arises above the background signal is called the cycle threshold (Ct). In total, 10 of the reverse transcription volume was used for each PCR reaction in a total volume of 50 Since a multiplex PCR reaction is carried out, each reaction tube contains more than one primer pair: one primer pair amplifies the target and another pair amplifies the endogenous reference. Primer and probe concentration for the target gene were optimised according to the manufacturer's procedure. The primers and probe of the predeveloped assay on demand were used according to the manufacturer's guidelines. As described by Livak and Schmittgen (2001), results are expressed as relative gene expression (RGE) using the Ct method. The calibrator was produced from the blood of a healthy volunteer spiked with 5 MDA MB361 cells per 106 MNC. The calibrator was given a RGE value of 100. Cell linesThe cell lines were cultured in Dulbecco's MEM culture medium (MCF 7 and MDA MB231) and in Leibovitz medium for MDA MB361. MCF 7 and MDA MB231 cells were cultured at 37 in a 5 CO2 atmosphere. The medium was replaced twice a week. MDA MB361 cells were cultured in the normal atmosphere and the medium was replaced only once a week. Culture cells were harvested according to the American Type Culture Collection (ATCC) guidelines. For total RNA isolation, cells were pelleted and washed twice with PBS. Pellets were resuspended in RLT buffer (Qiagen), and RNA was prepared according to the Rneasy midi protocol. Standard curvesA standard curve was constructed with a six fold serial dilution of cDNA obtained from an MDA MB361 breast cancer cell line. The standard curve was composed of six points with an equivalent of 200, 100, 40 and 20, 2 and 0.2 MDA MB361 total RNA. This standard curve was presented as an XY scatter plot, where the X axis represents the log of the input amount (log pg of starting total RNA) and the Y axis the corresponding Ct value.

Equations were derived from the curves. Sensitivity of CK 19 and hMAM RT was tested on limiting dilutions of a BM aspirate spiked with MDA MB361 cells to obtain the following concentrations: 0, 0.5, 1, 2, 5, 10, 50, 100, 1000 and 10 cells per 106 MNC.


Prev: pandora charms official website
Next: unique pandora charms

Get in touch

If you have any queries or if we can be of any further assistance please do not hesitate to contact us by any means preferable to you. For your convenience High Quality Pandora Earrings offers global assistance 24-hours a day, seven days a week. We also include an option to locate your nearest Pandora Earrings Outlet store.